ncert solutions class 12 biology

NCERT Solutions for Class 12 Biology : Biology may seem to be easy but sometimes it might get tough. The national council of education and training (NCERT) has set a curriculum for schools that follow the central board of secondary education (CBSE). NCERT solutions have been provided below to aid the students with answering the questions correctly, using a logical approach and methodology. The solutions provide ample material to enable students to form a good base with the fundamentals of the subject.

NCERT textbooks are prescribed by CBSE as the best books for preparation for the school as well as board examinations. The textbooks are deemed as more than enough, without any aid from other refreshers. The solutions are designed keeping in mind the language and the simplicity of the explanations that are given in the NCERT textbooks. Not just the board and school examinations, NCERT textbooks are known to play a very important role in JEE and NEET.

NCERT Solutions For Class 12 Biology Environmental Issues

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 16 Environmental Issues:

Section NameTopic Name
16Environmental Issues
16.1Air Pollution and Its Control
16.2Water Pollution and Its Control
16.3Solid Wastes
16.4Agro-chemicals and their Effects
16.5Radioactive Wastes
16.6Greenhouse Effect and Global Warming
16.7Ozone Depletion in the Stratosphere
16.8Degradation by Improper Resource Utilisation and Maintenance
16.9Deforestation
16.10Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. What are the various constituents of domestic sewage? Discuss the effects of sewage discharge on a river.
Ans:  Domestic sewage contains four kind of impurities:
(i) Suspended solids: They are soil particles such as sand and silt.
(ii) Colloidal particles: They are inorganic and organic materials such as faecal matter, bacteria, paper and cloth.
(iii) Dissolved solids : They are nitrates, phosphates, ammonia, sodium, calcium and other nutrients.
(iv) Pathogens : Domestic sewage has pathogens of various diseases such as typhoid, cholera, dysentery, diarrhoea, etc. Effect of sewage discharge on river are:
(i) Eutrophication.
(ii) Growth of pathogenic bacteria.
(iii) Ageing of river where slit and decaying matters start accumulating and filling river.
(iv) Increase in BOD.
(v) Destruction of flora and fauna of that river.

2. List all the wastes that you generate at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?
Ans: Waste materials generated at home : paper, disposable cups, cloth, plates, spoons, plastic envelopes, discarded food etc.

Waste materials generated at school are : paper, chalks, plastic envelopes etc.

Wastes materials generated during trips are : paper, disposable cups, plates, spoons, plastic envelopes, discarded food etc.

No, we cannot reduce the generation of these wastes easily, but few can be reduced. The wastes belong to two categories : biodegradable and non-biodegradable. It is difficult or rather impossible to reduce discarded food like peel of potato, peel of banana etc. We can do one important thing i.e., to reduce wastage of food.

3. Discuss the causes and effects of global warming. What measures need to be taken to control global warming?
Ans: Increase in atmospheric concentration of green house gases has resulted in rise of atmospheric temperature by 0.6°C (global wanning) in die 20th century. This has been confirmed by intergovernmental panel on climatic change (IPCC) in its reports of 1991 and 1992. This predictable change in near future may affect climate, sea level, range of species distribution, food production as well as fisheries resources in the oceans.
Causes of global warming:
(i) Increase in concentration of greenhouse gases.
(ii) Increase of automobile and use of fossil fuel.
(iii) Deforestation and change in land use.
(iv) CFC and aerosol emission from refrigerator and aeroplane.
(v) Increased particulate matter in lower atmosphere.
Effects of global warming:
(i) CO2 fertilisation effect.
(ii )Many species of plants, being sensitive to temperature will die with sudden rise in temperature and their place will be taken over by scrub vegetation.
(iii) Loss of biodiversity.
(iv) Rise in sea level.
(v) Possibilities of drought and floods.
(vi) Erruption of plant disease and pests.
(vii) Change in rainfall pattern.
Methods that can reduce the atmospheric concentration of greenhouses gases are
(i) Reducing the greenhouse gas emission by limiting the use of fossil fuels, and by developing alternative renewable sources of energy (wind energy, solar energy etc.)
(ii) Increasing the vegetation cover, mainly the forests, for photosynthetic utilization of CO2.
(iii) Minimizing the use of nitrogen fertilizers in agriculture for reducing N2O emissions.
(iv) Developing substitutes for chlorofluorocarbons.

4. Match the items given in column A and B:
NCERT Solutions For Class 12 Biology Environmental Issues Q4
Ans: (a)-(iii),(b)-(iv),(c)-(i),(d)-(ii)

5. Write critical notes on the following:
(a) Eutrophication
(b) Biological magnification
(c) Groundwater depletion and ways for its replenishment
Ans: (a) Eutrophication : It is excessive growth of algae, plants and animals in water bodies due to the nutrient enrichment particularly with nitrogen and phosphorus. It is both natural and accelerated. It leads to loss of bio-diversity and cuases chemical accumulation in food chain and ageing of water body.

(b) Biological magnification : Increase in concentration of persistent chemical at successive trophic levels is called eutrophication. This happens because a toxic substance accumulated by an organism can not be metabolized or excreted, and is thus passed onto next trophic level, e.g., DDT.

(c) Ground water depletion and replacement: Ground water depletion, a term often defined as long term water level declines caused by sustained ground water pumping, is a key issue associated with ground water use. Many areas of India experiencing ground water depletion.
The most servere consequence of excessive ground water pumping is that the water table, below which the ground is saturated – with water, can be lowered. If ground water level declines too far, then the well owner might have to deepen the well, drill a new well, or at least attempt to lower the pump.

6. Why ozone hole forms over Antarctica? How will enhanced ultraviolet radiation affect us?
Ans: Chlorofluorocarbons, mainly released in the atmosphere by developed countries, Slowly enters the stratosphere and the winds move them towards the poles. Environmental conditions prevailing in Antarctica during winter months; there is no sunlight in Antarctica and extremely low temperature ( – 85°C) facilitates the formation of ice clouds. During winter, natural circulation of wind (polar vertex) completely isolates Antarctic air from the rest of the world.

The ice clouds provide the catalytic surface for the reaction of chlorine atoms and then ozone. But this degradation of ozone occurs with the return of solar radiations to Antarctica during spring (September and October). This results in the thinning of ozone layer every year over most of Antarctica. This hole disappears in summer due to warming up of air and the mixing up of Antarctic air with that of the rest of the world.
Enhanced UV radiations on earth would affect humans and other animals by causing:

  • Skin cancer
  • Blindness and increased chances of cataract in eyes.
  • Malfunctioning of immune system.
  • Higher number of mutations.

7. Discuss the role of women and communities in protection and conservation of forests.
Ans: Amrita Bishnoi Wildlife protection project The Bishnoi community is known for its peaceful coexistence with nature. It was in 1730 AD. Amrita Devi protested against king’s men’s attemptto cut trees as it was prohibited in Bishnoi religion. It was a party of Maharaja Abhay Singhji, Rular of Marwar (Jodhpur) state who wanted to fell green khejdali trees. Amrita Devi fy her three daughter & more than 360 of other Bishnois lost their lives in saving trees & became martyers. Later ‘Chipko’ movement’ was started by Sunderlal Bahuguna and others to prevent cutting of trees. The people showed enormous bravery in protecting trees from the axe of contractors by hugging them.

8. What measures, as an individual, would you take to reduce environmental pollution?
Ans: To reduce environmental pollution we should take following measures:
(i) Reducing use of CFC.
(ii) Disposing off waste safely.
(iii) Reducing use of polythene.
(iv) Not disposing off waste in water bodies.
(v) Making automobiles pollution free.
(iv) Prevention of noise pollution by using fire crackers/TV/musical instruments at permissible limits.
(vii) Tree plantation in school, around residence.

9. Discuss briefly the following:
(a) Radioactive wastes
(b) Defunct ships and e-wastes
(c) Municipal solid wastes
Ans: (a) Radioactive waste : Radioactive waste include materials that are radioactive & for which there is no further practical use. These are generated by nuclear reactor, nuclear fallout, man made (refining and mining of platinum and thorium), natural radioactive waste and release of radiation in radiation therapy.
Increased risk of cancer, birth defects & infertility are few harmful effects caused by nuclear waste. So, nuclear waste is an extremely potent pollutant.

(b) Defunct ships & e-wastes – The dismantling of defunct ship is a technically complex process, which is potentially harmful to the environment & human health. Defunct i ships contain toxicants like asbestos, mercury, etc. The workers breaking the ships are not suitably protected and are exposed to toxic chemicals. The coastal areas in the vicinity of the ship-breaking yard also becomes polluted. At the international level, it is accepted that there is uncertainty about the relevant controls for the dismantling of such vessels & there is an urgent need to establish a specific enforceable control framework.
Electronic waste comprised of irrepairable computer and other electronic goods, generated by developed countries.
It is valuable source of secondary raw materials, if treated properly, however if not treated properly it is the major source of toxins. Eventually recycling is the only solution for the treatment of e-wastes provided it is carried out in an environment friendly manner.

(c) Municipal solid wastes : These are commonly known as trash or garbage. It consists of everyday items such as product packaging, furniture, clothing, bottles, food scraps, newspapers.
appliances, paints, batteries etc. Source reduction, recycling and compositing are several municipal social waste management practices. Source reduction involves altering the design, manufacture or use of products & materials to reduce die amount and toxicity of what gets thrown away. Recycling diverts items such as paper, glass, plastic & metals into anew products. Composting decomposes organic waste such as food scraps & yard trimmings with micro-organisms, producing a humus-like substance.

10. What initiatives were taken for reducing vehicular air pollution in Delhi? Has air quality improved in Delhi?
Ans: The initiatives were taken for reducing vehicular air pollution in Delhi are :-
(i) Introduction of CNG
(ii) Enforcement of pollution control law
(iii) Introduction of green zones
(iv) Use of unleaded fuels
(v) Replacement of old vehicle with new one. The result is that the air quality of Delhi has improved considerably with a substantial fall in pollutant gases.
(vi)Use of catalytic converters in vehicles.
(vii)Application of Euro II norms for vehicle.

11. Discuss briefly the following:
(a) Greenhouse gases
(b) Catalytic converter
(c) Ultraviolet B
Ans: (a) Greenhouse gases: Gases that trap the heat of the sun in the earth’s atmosphere increasing atmospheric temperature effect are called greenhouses gases. CO2, CH4, N2O and CFC, cause greenhouse. In the absence of greenhouse gases, the temperature of earth would go down to -18°C. The net effect of higher GHGs will be disastrous, (i) Melting of polar ice caps and mountain snow caps resulting in rising of sea level threatening submergence of many islands and coastal areas. Odd climate changes like El Nino. Increased floods and drought.
(b) Catalytic converter : Catalytic converter ‘are used to reduce emission of poisonous gases like nitrogen oxides, carbon monoxide & un reacted hydrocarbon in automotive emission. It is made of platinum, palladium and rhodium and is used as catalyst. It converts unbumt hydrocarbons into CO2. The only precaution required is not to use gasoline having lead as lead inactivates the catalysts of the converter.
(c) Ultraviolet B : Ultraviolet B is one of the three types of invisible light rays given off by the sun. Ultraviolet B penetrates the ozone layer in attenuated form & reaches earths. This is more over equator than poles due to thinning of ozone shield over equator. It causes skin cancer, reduce rate of photosynthesis in phytoplanktons, reduces diversity of aquatic ecosystem.

NCERT Solutions For Class 12 Biology Ecosystem

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 14 Ecosystem:

Section NameTopic Name
14Ecosystem
14.1Ecosystem–Structure and Function
14.2Productivity
14.3Decomposition
14.4Energy Flow
14.5Ecological Pyramids
14.6Ecological Succession
14.7Nutrient Cycling
14.8Ecosystem Services
14.9Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Fill in the blanks.
(a) Plants are called as————- because they fix carbon dioxide.
(b) In an ecosystem dominated by trees, the pyramid (of numbers) is————- type.
(c) In aquatic ecosystems, the limiting factor for the productivity is————- .
(d) Common detritivores in our ecosystem are————- .
(e) The major reservoir of carbon on earth is————- .
Ans: (a) Autotrophs
(b) Spindle
(c) Sunlight
(d) Earthworm, bacteria & fungi of decay and vulture
(e) Oceans

2. Which one of the following has the largest population in a food chain?
(a) Producers
(b) Primary consumers
(c) Secondary consumers.
(d) Decomposers
Ans: (d)

3. The second trophic level in a lake is-
(a) Phytoplankton
(b) Zooplankton
(c) Benthos
(d) Fishes
Ans: (b)

4. Secondary producers are
(a) Herbivores
(b) Producers
(c) Carnivores
(d) None of the above
Ans: (d)

5. What is the percentage of photo synthetically act., radiation (PAR), in the incident solar radiation?
(a) 100%
(b) 50 %

(c) 1-5%
(d) 2-10%

Ans: (b)

6. Distinguish between
(a) Grazing food chain and detritus food chain
(b) Production and decomposition
(c) ‘Upright and inverted pyramid
(d) Food chain and food web
(e) Litter and detritus
(f) Primary and secondary productivity
Ans: (a) Grazing Food Chain (GFC) begins with primary producers or plants and ends in carnivores (tertiary or top carnivores) whereas Detritus Food Chain (DFC) begins with detritus or dead organic matter and it ends in carnivores. In GFC, energy for the food chain comes from sun whereas in DFC, energy for the food chain comes from organic remains or detritus.

(b) Production is the phenomenon in which the energy is produced by the process of synthesis of organic compound from inorganic substances (such as CO2, H2O & minerals) utilizing generally the sunlight. It traps energy.
Decomposition refers to the breakdown of complex organic matter into simpler ones. It releases energy.

(c) In upright pyramid (e.g., grassland & cropland ecosystem), biomass or number of organisms or amount of energy decreases
on moving to upper trophic levels while in an inverted pyramid (eg. tree ecosystem) these quantities tend to increase on going to successive trophic levels.

(d) A food chain is a sequence of different types of organisms by which the flow of energy occurs from one trophic level to another whereas food web is the network of various food chains inter-connected to each other. Food webs increase adaptability and competitiveness of the organisms.

(e) Litter is the dead organic material fallen on the surface of the soil like leaves, remains of animals and excreta. Detritus is the dead organic matter found below the soil surface which is eaten up by the detritivores or broken down by decomposers.

(f) Primary productivity is the rate of synthesis of biomass or energy fixation by the plants. It is comparatively quite high.
Secondary productivity is the rate of synthesis of biomass by consumers (herbivores and carnivores). It is small and decreases with rise of trophic level.

7. Describe the components of an ecosystem.
Ans: The components of an ecosystem are as follows :

  1. Abiotic components or non living components : These include inorganic substances or minerals (standing state or standing quality), organic substances and different climatic conditions like temperature, pH, light, etc.
  2. Biotic components or living components :

(a) Autotrophs or producers which have capacity to manufacture their own food or which can fix radiant energy of sun into chemical energy, e.g., green plants and photosynthetic bacteria.

(b) Heterotrophs or consumers which are unable to manufacture their own food and depend upon other organisms for their food. These are of following types:

  • Primary consumers or herbivores which depend upon producers or green plants for their food.
  • Secondary consumers or carnivores which live upon herbivores.
  • Top consumers or top carnivores which live upon secondary consumers.

(c) Decomposers or microconsumers decompose dead organic substances of producers and consumers into simple substances and thus continue mineral cycles, e.g., bacteria, fungi, actinomycetes etc.

8. Define’ecological pyramids and describe with examples, pyramids of number and biomass.
Ans:  Ecological pyramid is a graphical method to show the number of organisms or biomass or amount of energy present at different trophic levels. Pyramid of number: Number of individuals at each trophic level is shown in pyramid. The pyramid of number (for example of a grassland) is upright. In this there is a decrease in the number of organisms starting from primary producers (plants) to top consumers (carnivores). Pyramid of biomass : Pyramid of biomass is graphic representation of amount of biomass per unit area sequence wise in rising trophic levels with producers at the base and top carnivores at the apex. Pyramids of biomass of a tree or . grassland ecosystem are upright and the pyramid of a pond ecosystem is inverted.
NCERT Solutions For Class 12 Biology Ecosystem Q8

9. What is primary productivity? Give brief description of factors that affect primary productivity.
Ans: Primary productivity of an ecosystem is the amount of energy fixed or biomass synthesized by primary producers or green plants per unit area per unit time during photosynthesis. Factors affecting primary productivity are –
-Plant species inhabiting a particular area
-Sunlight
-Temperature
-Soil water
-Nutrients
lit deserts, sunlight is abundant but water is scarce or nutrients are lacking. Therefore, in such areas, water & nutrients supply become the limiting factors.

10. Define decomposition and describe the processes and products of decomposition.
Ans: The process by which decomposers break down complex organic remains (dead plants, animal remains and excretions) into inorganic substances like carbon dioxide, water and nutrients is called decomposition. The important steps in the process of decomposition are fragmentation, leaching, catabolism, humification and mineralisation. Detritivores (e.g., earthworm) break down detritus into smaller particles. This process is called fragmentation.

By the process of leaching, water-soluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts.

Bacterial and fungal enzymes degrade detritus into simpler inorganic substances. The process is called as catabolism.

All the above steps in decomposition operate simultaneously on the detritus. Humification and mineralisation occur during decomposition in the soil.

Humification leads to accumulation of a dark coloured amorphous substance called humus that is highly resistant to microbial action and undergoes decomposition at an extremely slow rate. Being colloidal in nature it serves as a reservoir of nutrients.

The humus is further degraded by some microbes and release of inorganic nutrients occur by the process known as mineralisation.

11. Give an account of energy flow in an ecosystem.
Ans: Flow of energy in an ecosystem is unidirectional. The ultimate source of energy is sun. The solar energy is captured by the green plants which utilize it in synthesizing their own food. The energy fixed by the green plants is transferred to herbivores which feed on them. The energy is then transferred to higher trophic levels (carnivores). At every step, considerable amount of energy is lost. According to 10% law, only 10% of total energy stored in a trophic level is transferred to the next trophic level of a food chain.

12. Write important features of a sedimentary cycle in an ecosystem.
Ans: The movement of nutrient elements through various components of an ecosystem takes place by a biogeochemical cycle. It is of 2 types – gaseous and sedimentary. A nutrient that does not enter the atmosphere easily is said to have a sedimentary cycle. Sedimentary cycle involve cycling of sulphur, phosphorus etc. which are located in earth’s crust.
Phosphorus is a very important element as it is present in various substances found in living beings. The cycling of phosphorus in an ecosystem occurs in such a way that plants obtain it from soil or rocks. The animals or primary consumers obtain it from plants. Secondary consumers or carnivores take it from herbivores while omnivores (like man) receive it both from plants and animals. Phosphorus present in organisms is also released during decomposition.

13. Outline salient features of carbon cycling in an ecosystem.
Ans:  Carbon is an important constituent of living matter. Green plants take it in the form of C02 from atmosphere and fix it as carbohydrates. Carbon which is also present in proteins, fats etc. is transferred to the organisms of other trophic levels. Apart from being released in atmosphere as C02 during respiration, carbon is also released in atmosphere through burning of wood, fossil fuel and decomposition of organic matter by microbes.
NCERT Solutions For Class 12 Biology Ecosystem Q13

More Resources for CBSE Class 12:

NCERT Solutions For Class 12 Biology Organisms and Populations

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 13 Organisms and Populations:

Section NameTopic Name
13ORGANISMS AND POPULATIONS
13.1Organism and Its Environment
13.2Populations
13.3Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. How is diapause different from hibernation?
Ans: Diapause is a period of suspended growth or development occuring in many insects and other invertebrates during which metabolic activities are greatly reduced. On the other hand, hibernation is a sleep like state in which a few animals, such as fishes and amphibians, pass the winter season as a way of surviving food scarcity and cold weather.

2. If a marine fish is placed in a fresh water aquarium, will the fish be able to survive? Why or why not?
Ans: When a marine fish is placed in a fresh water aquarium, the fish will not be able to survive because marine fish is adapted to live in saline seawater. In fresh water, it will not be able to cope with the outside hypotonic environment because of osmoregulation problem. In fresh water, the concentration of water, the difference between the concentration of the water and inside of the fish are increased and therefore, the osmotic pressure is also increased.The fish has to take more water into the body to be able to survive and to get rid of the excess salt present in its body.

3. Define phenotypic adaptation. Give one example.
Ans: Phenotypic adaptations are non-genetic changes
occurring in living organisms due to various extreme environmental conditions, such as stress, extreme temperature, change of habitat. These includes acclimatization, behavioural changes, etc.

4. Most living organisms cannot survive at temperature above 45°C. How are some microbes able to live in habitats with temperatures exceeding 100°C?
Ans: Micro-organisms of hot.springs and vents (mouth of sea bed volcanoes) are able to survive at the high temperature due to
(i) occurrence of branched chain lipids in their cell membrane that reduce fluidity of cell membranes.
(ii) having minimum amount of free water in their bodies. Removal of water provides resistance to high temperature.

5. Last the attributes that populations but not individuals possess.
Ans: Some significant attributes that populations but not individual possess are –
(i) Natality
(ii) Mortality
(iii) Growth forms
(iv) Population density
(v) Population dispersion
(vi) Population age distribution
(vii) Sex ratio

6. If a population growing exponentially double in size in 3 years, what is the intrinsic rate of increase (r) of the population?
Ans: If the population growing exponentially double in size in 3 years, the intrinsic rate of increase of this population will be towards maximum.

7. Name important defence mechanisms in plants against herbivory.
Ans: There are various defence measures for animals against predators. But plants, as they cannot move away, have certain defence mechanisms against herbivory. Their main defences are chemical toxins, such as strychnine, a poison produced by tropical vine, morphine by opium poppy, nicotine produced by tobacco plant. Apart from these chemicals, the common defence measure is presence of spines (modified leaves) on the leaves, stems of the plant, modifications of leaves into thorns, development of sharp silicated edges in leaves which prevent them against damage caused by herbivores.

8. An orchid plant is growing on the branch of mango tree. How do you describe this interaction between the orchid and the mango tree?
Ans: An orchid plant is growing on the branch of a mango tree is called epiphyte, i.e., plants growing on other plants or trees. This type of interaction is known as commensalism, where in orchid / derives benefit of interaction whereas mango tree is not affected. The orchid growing on the branch of mango tree get more light to grow and also, the mango is not harmed in any way.
Commensalism can be defined as an interaction between two animal or plant species that habitually live together in which one species benefits from the association while the other is not significantly affected.

9. What is the ecological principle behind the biological control method of managing with pest insects?
Ans: The ecological principle behind the biological control method of managing with pest insects is predator – prey relationship. It is based on the ability of the predator to regulate prey population.

10. Distinguish between the following:
(a) Hibernation and Aestivation
(b) Ectotherms and Endotherms
Ans:
NCERT Solutions For Class 12 Biology Organisms and Populations Q10

NCERT Solutions For Class 12 Biology Organisms and Populations Q10.1

11. Write a short note on
(a) Adaptations of desert plants and animals
(b) Adaptations of plants to water scarcity
(c) Behavioural adaptations in animals
(d) Importance of light to plants
(e) Effect of temperature or water scarcity and the adaptations of animals.
Ans: (a) Desert plants have very small leaves or no leaves at all, and carrying out photosynthesis through the stems. Their stem could become succulent, and can store and retain water. Animals living in hot climatic region tend to be smaller than those living in cold climates. This can be explained by the fact that the amount of heat gained from the environment is approximately proportional to the body surface area. The majority of animals living in desert are small, like kangaroo rat. It feed on dry seeds and other dry plant material and does not drink,

(b) The evergreen trees such as Rhododendron, show water scarcity by an inward curling of the leaves. A more significant response is the closure of stomata, which reduces transpiration, but raises the internal temperature of die leaf affecting the rate of synthesis of proteins and photosynthesis. Deciduous trees of the temperature region drop their leaves in autumn, avoiding winter drought. Some water stressed plant’s accumulate excessive amounts of inorganic ions.

(c) Migrating temporarily to a less stressful habitat forms a more stressful habitat is a kind of behavioural adaptation in animals which enables them to survive in better environmental conditions. Desert lizards regulate their body temperature constant by behavioural means. They bask in the sun and absorb heat when their body temperature decreases below the optimum, but move into shady or underground places when the temperature of the surrounding area starts increasing.

(d) Light affects plants through its quality, intensity and duration. Duration of light affects phenology, photosynthesis, growth, reproduction, flowering. Quality of light influences flowering, seed germination and movements. Light is required for the production of chlorophyll in chloroplasts. Plants germinated under insufficient illumination causes the destruction of chlorophyll.

(e) Animals mainly are of two types as they are adapted to controlling their body temperature. Poikilothermous are the animals whose temperature fluctuates with that of the environment, e.g., invertebrates and vertebrates, other than birds and animals. In contrast, homeotherms are the animals which can maintain their body temperature at a constant level, e.g., birds and mammals.

12. List the various abiotic environmental factors.
Ans: Abiotic factors are non living factors and conditions of the environment which influence survival, function and behaviour of organisms. Various abiotic factors are :

(i) Temperature – Temperature is one of the most important environmental factors. The average temperature varies seasonally. It ranges from subzero level in polar areas and high altitudes to more than 50°C in tropical deserts in summer and exceeds 100°C in thermal springs and deep-sea hydrothermal vents.

(ii) Water – Next to temperature, water is the most important factor which influences the life of organisms. The productivity and distribution of land plants are dependent upon availability of water. Animals are adapted according to the water availability. E.g., aquatic animals are ammonotelic while xerophytic animals excrete dry feces and concentrated urine.

(iii) Light – Plants produce food through photosynthesis for which sunlight is essential source of energy. Light intensity, light duration and light quality influences the number of life processes in organisms, such as – photosynthesis, growth, trans-piration, germination, pigmentation, movement and photoperiodism.

(iv) Humidity – Humidity refers to the moisture (water vapour) content of the air. It determines the formation of clouds, dew and fog. It affects the land organisms by regulating the loss of water as vapour from their bodies through evaporation, perspiration and transpiration.

(v) Precipitation – Precipitation means rainfall, snow, sleet or dew. Total annual rainfall, seasonal distribution humidity of the air and amount of water retained in the soil are the main criteria that limit the distribution of plants and animals on land.

(vi) Soil – The soil is one of the most important ecological factor called the edaphic factor. It comprises of different layers called horizons. The upper weathered humus containing part of soil sustains terrestrial plant life.

13. Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of the benthic zone
Ans: (a) Man, (Homo sapiens)
(b) Black bear
(c) Corals

14. Define population and community.
Ans: Population can be defined as the total number of individuals of a species or any other class of an organism in a defined area or habitat or a group of individuals of the same species within a commnity.
Community can be defined as a naturally octurring assemblage of species living within a defined area or habitat.

15. Define the following terms and give one example for each:
(a) Commensalism
(b) Parasitism

(c) Camouflage (d)Mutualism
(e) Interspecific competition
Ans: (a) Commensalism is the association between organisms of different species in which one species benefits but does not apparent harm to the other. For example, in the large intestine of human being, bacteria Escherichia coli are present which helps in digestion.
(b) Parasitism is an association in which one organism lives on or in the body of another, from which it obtains its food. For example, the parasites of humans include fleas and lice, various bacteria, protozoans and fungi.
(c) Camouflage is a high degree of similarity between an animal and its visual environment, which enables it be disguished or concealed. For example, birds with necks and heads of contrasting colours are not easily recognised by their enemies under certain conditions.
(d) Mutualism is an association between two organisms of different species in which each partner benefits. For example, the cross fertilization or pollination of plant flowers by insects (sometimes by birds) is a mutual relation of wide occurrence and great importance, because many plants are self- sterile.
(e) Inter-specific competition can be defined as an interaction occurs between different species that share some environmental resource when this is in short supply. Inter-specific competition often results in the dominance of one species over another. For example, when two species of Paramoecium,Paramoecium caudatum and P.aurelia are confined in a closed containers with fixed amount of food, out of them one species always died out.

16. With the help of suitable diagram describe the . ; logistic population growth curve.
Ans: The S-shaped growth curve is also called a logistic growth curve. It describes a situation in which (in a new environmental condition) the population density of an organism increases slowly establishing itself then increasing rapidly, approaching an exponential growth rate. Many population of micro-organisms broadly follow this basic sigmoidal pattern. For example, when a fresh culture medium is inoculated with bacteria, sigmoidal or S-shaped growth curve is observed. The S-shaped curve is generated when a population approaches the environmental’s carrying capacity. Carrying capacity is the maximum number of individuals of a population that can be supported in a given time.
NCERT Solutions For Class 12 Biology Organisms and Populations Q16
The S-shaped growth form is represented by the following equation- ” dNldt = rN[K-NIK]
Where, r = intrinsic rate of natural increase N = population density at time t K = carrying capacity

17. Select the statement which explains best parasitism.
(a) One organism is benefited.
(b) Both the organisms are benefited.
(c) One organism is benefited, other is not affected.
(d) One organism is benefited, other is affected.
Ans:(d) One organism is benefited, other is affected.

18.List any three important characteristics of a population and explain.
Ans: The three important characteristics of a population are:
(a) Density: The number of individuals per unit area or volume. For example, the number of frogs per m3 of forest region.
(b) Natality or Birth rate: The birth rate is determined by the number of individuals bom to a given population during a given period of time.
(c) Mortality or Death rate: The death rate or mortality represents a decrease in a given population during a given period of time. Generally, the death of individuals in a population are expressed by specific mortality which is described as the mortality population are expressed by specific mortality which is described as the mortality for given age group.

NCERT Solutions For Class 12 Biology Biotechnology and its Applications

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 12 Biotechnology and its Applications:

Section NameTopic Name
12Biotechnology and its Applications
12.1Biotechnological Applications in Agriculture
12.2Biotechnological Applications in Medicine
12.3Transgenic Animals
12.4Ethical Issues
12.5Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because –
(a) bacteria are resistant to the toxin
(b) toxin is immature;
(c) toxin is inactive;
(d) bacteria encloses toxin in a special sac.
Ans: (c) Toxin is inactive.

2. What are transgenic bacteria? Illustrate using any one example.
Ans: Bacteria having gene or genes usually from an unrelated organism incorporated into their genome are called transgenic bacteria. For example, when human insulin gene is introduced into the isolated plasmid of E.coli bacterium and this recombinant DNA is transferred into a fresh bacterium, then the later is said to be transgenic or transformed bacterium.

3. Compare and contrast the advantages and disadvantages of production of genetically modified crops.
Ans:
NCERT Solutions For Class 12 Biology Biotechnology and its Applications Q3

4. What are Cry proteins? Name an organism that produces it. How has man exploited this protein to his benefit?
Ans: The bacterium Bacillus thuringiensis is a common soil bacterium which produces a protein toxin that kills certain insects. The toxin is a crystal (Cry) protein. There are several kinds of Cry proteins which are toxic to different groups of insects. The gene encoding Cry protein is called cry gene. Biotechnologists have been able to isolate the gene responsible for production of toxin and to introduce it into a number of plants to produce genetically modified plants resistant to insects, e.g., Bt cotton (resistant to bollworm) and GM tobacco (resistant to hornworms).

5. What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency.
Ans: Gene therapy is correction of malfunctioning/gen by repairing or adding correct copy. ADA (adenosine deaminase deficiency) is a very rare genetic disorder due to deletion of the gene for adenosine deaminase. The enzyme is crucial for the immune system to functions. It can be treated by gene therapy. This gene is transfected into early embryonic cells of bone marrow for permanent use.

6. Digrammatically represent the experimental steps in cloning and expressing an human gene (say the gene for growth hormone) into a bacterium like E. coli?
Ans:
NCERT Solutions For Class 12 Biology Biotechnology and its Applications Q6

7. Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of rDNA technology and chemistry of oil?
Ans: The genes for the formation of oil in the seed should be identified. The appropriate genes should be removed with the help of restriction endonucleases. Such DNA should then be treated with DNA ligases to make seal DNA at the broken ends. These cells when grown aseptically on nutrient medium will differentiate into a new plant whose seeds will not have oil in them.

8. Find out from internet what is golden rice.
Ans: Golden rice is a transgenic variety of rice (Oryza sativa) containing good quantities of β-carotene (provitamin A) which is principle source of vitamin A. Since the grains of the rice are yellow in colour due to β-carotene, the rice is commonly called golden rice. It was developed at Swiss Federal Institute of Technology by Professor Ingo Potrykus and Peter Beyer.

9. Does our blood have proteases and nucleases?
Ans: No, blood does not have protease and nuclease. If it would have been there blood and cell would have been digested, some protease do exist in inactive form.

10. Consult internet and find out how to make orally activ&protein pharmaceutical. What is the major problem to be encountered?
Ans: Orally active protein product that is successfully manufactured is vaccines for preventions of infectious diseases such as hepatitis B, herpes, influenza, etc. Gene for antigen are isolated from bacteria and grown along with cut leaf portions of potato plant in antibiotic medium – followed by callus formation and recombinant/transgenic potato are obtained which contain those vaccines.

NCERT Solutions For Class 12 Biology Biotechnology:Principles And Processes

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 11 Biotechnology: Principles And Processes:

Section NameTopic Name
11Biotechnology:Principles And Processes
11.1Principles of Biotechnology
11.2Tools of Recombinant DNA Technology
11.3Processes of Recombinant DNA Technology
11.4Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Can you list 10 recombinant proteins which are used in medical practice? Find out where they are used as therapeutics (use the internet).
Ans: (i) Human insulin – Diabetes
(ii) Human growth hormone – Dwarfism cure
(iii) Blood clotting factor Y1H/IX-Haemophilia
(iv) TPA (tissue plasminogen activator) – Heart attack/strokes
(v) PDGF (platelet derived growth factor) – Stimulates wound healing.
(vi) Interferon – Treatment of viral infection.
(vii) Interlinking – Enhances immune reaction,
(viii) Hepatitis B vaccine – Prevention of infectious disease.
(ix) Herpes Vaccine – Prevention of infectious disease.
(x) DNase I – Treatment of cystic fibrosis.

2. Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.
Ans: Name of the Restriction enzyme – Bam HI.
The substrate DNA on which it acts –
NCERT Solutions For Class 12 Biology Biotechnology Principles And Processes Q2

3. From what you have learnt, can you tell whether enzymes are bigger or DNA is bigger in molecular size? How did you know?
Ans: Both DNA (deoxyribonucleic acid) and enzymes are macromolecules. DNA is a polymer of deoxyribonucleotides and enzymes are proteins hence these are polymers of amino acids. But DNA is bigger in molecular size as compared to proteins because synthesis of proteins is regulated by a small segment of DNA, called genes and also a large number of proteins can be synthesised by a DNA molecule.

4. What would be the molar concentration of human DNA in a human cell? Consult your teacher.
Ans: The molar concentration of DNA in human cell is 2 mg/ml of cell extract.

5. Do eukaryotic cells have restriction endonucleases? Justify your answer.
Ans: No, eukaryotic cells do not have restriction endonuclease because DNA molecules of eukaryotes are heavily methylated. All the restriction endonucleases have been isolated from various strain of bacteria.

6. Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors have over shake flasks?
Ans: Shake flasks are used for growing and mixing the desired materials on a small scale in the laboratory. A large scale production of desired biotechnological product is done by using ‘bioreactors’. Besides better aeration and mixing properties, the bioreactors have following advantages
(i) Small volumes of cultures are periodically withdrawn from die reactor for sampling.
(ii) It has a foam control system, pH control system and temperature control system.
(iii) Facilitates even mixing and oxygen availability throughout the bioreactor.

7. Collect 5 examples of palindromic DNA sequences by consulting your teacher. Better try to create a palindromic sequence by following base-pair rules.
Ans: Palindrome nucleotide sequences in the DNA molecule are groups of bases that form the same sequence when read both forward and backward. Five examples of palindromic DNA sequences are as follows:
(i) 5′-—————GGATCC——————3’
3′—————CCTAGG—————–5′
(ii) 5’—————AAGCTT——————3′
3′——————TTCGAA —————-5′
(iii) 5′—————–ACGCGT—————–3′
3′——————TGCGGA————– 5′
(iv) 5′———- ACTAGT————3′
3′——————TGATCA————5′
(v) 5′—————AGGCCT—————3′
3′——————TCCGGA————–5′

8. Can you recall meiosis and indicate at what stage a recombinant DNA is made?
Ans: Recombinant DNA is formed due to crossing over between non-sister chromatids of homologous chromosome. It occurs during pachytene stage of prophase of meiosis I

9. Can you think and answer how a reporter enzyme can be used to monitor transformation of host cells by foreign DNA in addition to a selectable marker?
Ans: A reporter enzyme can be used to differentiate transformed cells by tracking down the activity of its co-responding genes (receptor gene). For e.g., (3-galactosidase (Lac Z) activity is not found in transformed cells so that they appear white in colour. The others, which appear blue in colour, indicate that cells do not carry foreign DNA.

10. Describe briefly the followings:
(a) Origin of replication
(b) Bioreactors
(c) Downstream processing
Ans: (a) Origin of Replication: This is a sequence from where replication starts and any piece of DNA when linked to this sequence can be made to replicate within the host cells. This sequence is also responsible for controlling the copy number of the linked DNA. So, if one wants to recover many copies of the target DNA it should be cloned in a vector whose origin support high copy number.

(b) Bioreactor: Bioreactors can be thought of as vessels in which raw materials are biologically converted into specific products by microbes, plant and animal cell and/or their enzymes. The bioreactor provides optimum growth conditions and facilitates achieving the desired products. The most commonly used bioreactor is of stirring type. A stirred tank bioreactor is usually a cylindrical vessel or vessel with a curved base to facilitate mixing of the contents. In the sparged stirred tank bioreactor, sterile air bubbles are sparged. The stirrer facilitates the mixing and oxygen availability throughout the bioreactor. A bioreactor has an agitator system, an oxygen delivery system, a foam control system, a temperature control system, pH control system and sampling ports.

(c) Downstream Processing : The product obtained is subjected to a series, of processes collectively called downstream processing before it is made into a finished product ready for marketing. The two main processes are separation and purification. The product is then formulated with suitable preservatives. Such formulations have to undergo clinical trials, in case of drugs.

11. Explain briefly
(a) PCR
(b) Restriction enzymes and DNA
(c) Chitinase
Ans: (a) PCR = Polymerase chain reaction (in vitro method) is a molecular biological technique for enzymatically replicating DNA without using a living organism, such as E. coli or yeast.
3 steps in PCR are –
(i) Denaturation of desired double strand DNA-to ssDNA.
(ii) Annealing of primer to ssDNA (single standard).
(iii) Extension of primer by Taq DNA polymerase isolated form Thermits aquaticus.
Uses – Amplification of desired gene/gene cloning.
Advantage- More output, greater efficiency, less error prone, less human interference and cyclic and automated.
(b) Restriction enzymes and DNA – Restriction enzymes is a group of enzymes used to cleave or cut DNA strands each having a characteristics base sequence at which it cleaves.
(i) It restricts foreign DNA from entering normal cell by digesting it at various recognition site. Recognition site is palindromic.
(ii) They are endonuclease and exonuclease both types.
(iii) They produces sticky ends. Cleavage site and recognition site are different from each other. Restriction enzymes therefore are believed to be a mechanism evolved by bacteria to resist viral attack and to help in the removal of viral sequences.
(c) Chitinase – Chitinase is a enzyme to digest or breakdown glycosidic bonds in chitin cell wall of fungal cell to facilitate its transformation.

NCERT Solutions For Class 12 Biology Microbes in Human Welfare

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 10 Microbes in Human Welfare:

Section NameTopic Name
10Microbes in Human Welfare
10.1Microbes in Household Products
10.2Microbes in Industrial Products
10.3Microbes in Sewage Treatment
10.4Microbes in Production of Biogas
10.5Microbes as Biocontrol Agents
10.6Microbes as Biofertilisers
10.7Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Bacteria cannot be seen with the naked eyes, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why?
Ans: Soil sample/water sample as they are the natural habitat of micro-organisms and can be directly observed.

2. Give examples to prove that microbes release, gases during metabolism.
Ans: There are lots of examples which prove, that microbes release gases during their metabolism. Some examples are as follows :

  • Dough, which is used for making dosa and idli is fermented by bacteria. The puffy appearance of dough is due to production of CO2 by fermentation process.
  • Swiss cheese is characterized by having the characteristic flavour and large holes. The large holes are formed due to the amount of CO2 released by a bacterium Propionibacterium sharmanii.

3. In which food would you find lactic acid bacteria? Mention some of their useful applications.
Ans: Milk, Curd and Cheese are coagulated product. Lactic acid bacteria (LAB) convert lactose sugar into lactic acid. They also improve the nutritional quality of curd by increasing vitamin B12. Lactic acid bacteria are also found in the stomach where they check disease causing microbes.

4. Name some traditional Indian foods made of wheat, rice and Bengal gram (or their products) which involve use of microbes.
Ans: A number of dishes can be prepared through fermentation process by using microbes. Some important traditional dishes made up of wheat, rice and Bengal gram or black gram (vernacular urad) are as follows :

  • Bread – It is a fermented preparation of wheat by Saccharomyces cerevisiae.
  • Dosa, upma and idli – They are fermented preparation of rice and black gram (urad). The two are allowed to ferment for 3-12 hrs with Leuconostoc and Streptococcus species of bacteria.

5. In which way have microbes played a major role in controlling diseases caused by harmful bacteria?
Ans: By production of antibiotics like penicillin, tetracyclin, by production of vaccines for herpes, TB, DPT, etc.

6. Name any two species of fungus, which are used in the production of the antibiotics.
Ans: Penicillium chrysogenum, P. notatum, produce penicillin and Cephalosporium produces cephalosporins.

7. What is sewage? In which way can sewage be harmful to us?
Ans: Sewage is waste water release from household and industrial applications. It is harmful as
(i) it decreases flora mid fauna of H2O.
(ii) contamination of H2O/food/soil.
(iii) dissemination of pathogenic bacteria.

8. What is the key difference between primary and secondary sewage treatment?
Ans: There are three stages of sewage treatment : primary, secondary and tertiary. Primary treatment is a physical process while secondary is a biological process and tertiary is a chemical process.

9. Do you think microbes can also be used as source of energy? If yes, how?
Ans: Yes, the microbes present in activated sludge are digested anaerobically to generate a biogas i.e. by release of inflammable biogas in biogas plant, which is a source of energy.
Use of microbial culture for SCP (single cell protein).

10. Microbes can be used to decrease the use of chemical fertilizers and pesticides. Explain how this can be accomplished.
Ans: Microbes can be used to decrease the use of chemical fertilizers and pesticides. This can be accomplished by the use of biofertilizers. The main source of biofertilizers are bacteria, fungi and cyanobacteria. They can provide plant nutrients at cheaper cost when compared with the chemical fertilizers. e.g.
(i) Use of leguminous plant with Rhizobium.
(ii) Use of sulphur fixing bacteria.
(iii) Use of hydrogen fixing bacterium.

11. Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labelled A, B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A, B and C were recorded as 20 mg/L, 8 mg/Land 400 mg/L, respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?
Ans: The sample with BOD value of 400 mg/h is most polluted and should be levelled as B —> untreated sewage river H2O will be —> less BOD —> 8 mg/L – sample A.
Untreated water —> 2° effluent BOD —>River water 400 —> 20 —> 8 and so should be labelled as sample C.

12. Find out the name of the microbes from which cyclosporin A (an immuno suppressive drug) and statins (blood cholesterol lowering agents) are obtained.
Ans: Cyclosporin A (an immuno suppressive drug) is obtained from fungus Trichoderma polysporum while statins (blood cholesterol lowering agent) is obtained from yeast Monascus purpureus.

13. Find out the role of microbes in the following and discuss it with your teacher.
(a) Single cell protein (SCP)
(b) Soil
Ans: SCP – single cell protein is microbial yield/cell crop of bacterial, yeast, algae rich in protein. The protein content of microbial cell is very high. Dried cell of Pseudomonas grown on petroleum product has 69% protein and these proteins have all essential amino acids.

Soil : Microbes take part in formation and maintenance of soil. They add organic matter to freshly formed soil. The process is called humification. Some microbes act as biofertilizers and biopesticides.

14. Arrange the following in the decreasing order (most important first) of their importance, for the welfare of human society. Give reasons for your answer.Biogas, Citric acid, Penicillin and Curd.
Ans: Curd: Less important for society – as it depends on individual use and has only nutritions value.
Citric acid : Industrial use, not for dissipation in community.
Penicillin: Medicinal use of microbes, good for health of society, commercially more usable.
Biogas: Most important for community welfare as
(i) it reduces excreta, waste from community.
(ii) it produces inflammable gases, can be used as energy source.
(iii) it is a renewable source.
(iv) it has multidimensional utility.
(v) it is easily maintained and dissipated for community purpose.
So,Penicillin > Biogas > Curd > Citric acid.

15. How do biofertilizers enrich the fertility of the soil?
Ans: Biofertilizers enrich the fertility of the soil by:
(i) replenishment of lost nutrients like N2, phosphorus, iron, sulphur.
(ii) addition of required micronutrients and macronutrients.
(iii) making humus acid compost.
(iv) acting as scavanger.

NCERT Solutions For Class 12 Biology Strategies for Enhancement in Food Production

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 9 Strategies for Enhancement in Food Production:

Section NameTopic Name
9Strategies for Enhancement in Food Production
9.1Animal Husbandry
9.2Plant Breeding
9.3Single Cell Proteins
9.4Tissue Culture
9.5Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Explain in brief the role of animal husbandry in human welfare.
Ans: Animal husbandry deals with the caring, feeding and management of domesticated animals. It includes poultry, farming and fisheries.
These animals are very useful for human beings because
(i) they provide products which are used as food like meat, milk, eggs, honey, etc.
(ii) there are some other substances obtained from animals which are beneficial to human beings like wool, silk, leather, bees wax etc.

2. If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production?
Ans: To improve the quality & quantity of milk production, one should take care of the following points:
(i) Proper feeding of the cattle with good quality of food.
(ii) Clean and hygienic environment for cattles.
(iii) Proper medication.
(iv) Veterinary supervision.
(v) Selection of good breeds having high yielding capacity combined with resistance to disease.
(vi) Quality of breed.

3. What is meant by the term ‘breed’ ? What are the objectives of animal breeding?
Ans: A group of animals related by descent and similar in most characters like general appearance, features, size, configuration etc. is called a breed.
The main objectives of animal breeding are:

  • To produce high yielding varieties of animals like high milk producing cattle, more egg producing varieties of chicken, more wool bearing sheep varieties etc.
  • To produce drought varieties for doing work like cattle, etc.
  • To produce disease resistant varieties of the livestocks.

4. Name the methods employed in animal breeding. According to you which of the methods is best? Why?
Ans: Methods employed in animal breeding are
(i) Inbreeding
(ii) Out-breeding
(iii) Cross-breeding
(iv) Interspecific hybridization
(v) Artificial insemination
(vi) Multiple Ovulation Embryo Transfer Cross breeding is the best method as it results in the development of superior traits of both the breeds and the progeny produced are fertile and there is no inbreeding depression.

5. What is apiculture? How is it important in our lives?
Ans: Apiculture is the rearing and breeding of honeybees for the production of honey .
It is important in our live as honeybees provide honey, which is a highly nutritive substance and beeswax is used in many industries. Honeybees also pollinate flowers of some very important plants like sunflower, apple, pear.

6. Discuss the role of fishery in enhancement of food production.
Ans: Fishery is an industry which is concerned with the catching, processing or selling of fish. The role of fishery in enhancement of food production is as follows :

  1. The fish flesh is an excellent source of protein. It has very little fat, carries a good amount of minerals and vitamins A and D and is rich in iodine.
  2. Fish oil extracted from the liver of the sharks, sawfishes, etc., has medicinal value.
  3. Shagreen, the skin of sharks and rays are used in polishing the wood and other materials.
  4. The silvery bony scales of cyprimids are used in the manufacture of artificial pearls.
  5. Fish glue is a sticky product obtained from the skin of cod and is used as gum.
  6. Fish waste after the extraction of oil is used as fertilizer.
  7. The fishing industry has brought a lot of income to the farmers in particular and the country in general because of “Blue Revolution” (fish production) in the same lines as ‘Green Revolution’ (for producing enough food for all).

7. Briefly describe various steps involved in plant breeding.
Ans: Plant breeding is a purposeful manipulation of plant species in order to create desired plant types that are better suited for cultivation, give better yields and are disease resistant. The given flow chart shows various steps involved in plant breeding.

8. Explain what is meant by biofortification.
Ans: Enhancement of nutritional quality of a crop by improving the content and quality of protein, fats, vitamins, minerals and micronutrient is called biofortification. It helps to improve public health.

9. Which part of the plant is best suited for making virus-free plants and why?
Ans: The apical and axillary meristems of plants are the best parts of the plant to make virus-free plants. This is because rate of division of meristematic cell is higher than rate of multiplication of virus and viruses are unable to invade newly formed meristematic cells. Hence, meristematic cells are free of virus although the whole plant is infected with virus. With the use of meristem, a healthy plant can be recovered from the diseased plant through micropropagation method.

10. What is the major advantage of producing plants by micro propagation?
Ans: It is faster method of producing a large number of plants. Plants formed by micro propagation are identical.

11. Find out the various components of the medium 12.used for propagation of an explant in vitro are ?
Ans: The various components of the medium used for propagation of an explant in vitro are
-Sucrose (source of energy & carbon)
-Inorganic salts
-Vitamins
-Growth regulators (auxins and cytokinins)

12. Name any five hybrid varieties of crop plants which have been developed in India.
Ans: Sonalika (wheat)
Himgiri (wheat)
Pusa Swamim (mustard)
PusaSem2 (bean)
Pusa Sawani (lady’s finger)

More Resources for CBSE Class 12:

NCERT Solutions For Class 12 Biology Human Health and Disease

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 8 Human Health and Disease:

Section NameTopic Name
8Human Health and Disease
8.1Common Diseases in Humans
8.2Immunity
8.3AIDS
8.4Cancer
8.5Drugs and Alcohol Abuse
8.6Summary

QUESTIONS FROM TEXTBOOK SOLVED

1.What are the various public health measures, which you would suggest as safeguard against infectious diseases?
Ans. The various public health measures against infectious diseases includes the following –
1.Education – People should be educated about the infectious diseases so that they may protect themselves against the infections.
2.A people suffering from any infections should be isolated to avoid its transmission to any other person.
3.Vaccination – People should get vaccination to avoid infection. Vaccination is available against cholera, typhoid, TB etc.
4.Sanitation – Sanitary surroundings can prevent spread of diseases. Public hygiene includes – suitable disposal of waste & human excreta; periodic cleaning and disinfection of water sources; observing normal practices of hygiene in public catering. Personal hygiene includes keeping the body clean, intake of clean drinking water, vegetables, fruits etc.
5.Eradication of vectors – The breeding places of vectors should be destroyed & adult vectors killed by appropriate methods.

2.In which way has the study of biology helped us to control infectious diseases?
Ans.The science that makes a study of diseases is called pathology, though in a broad sense it includes diagnostic, prophylactic and curative measures too. Pathology is a study of diseases of all kinds though we will confine ourselves to the diseases caused by a pathogenic organism, the reaction of the host as shown in the form of symptoms, the diagnosis made through a study of their symptoms, etiology of the pathogenic organism and finally steps undertaken to cure the host of its diseases, by eradicating and if it is not possible, by controlling the pathogen. In this way the study of biology helped us to control infectious diseases.

3. Hovy does the transmission of each of the following diseases take place?
(a)Amoebiasis (b) Malaria
(c)Ascariasis (d) Pneumonia
Ans. (a) Amoebiasis – It is usually contracted by ingesting water or food contaminated by amoebic cysts.
(b)Malaria – It is transmitted from one person to another by the female Anopheles mosquito. The mosquito picks up the parasite along with the blood when it bites an infected person. When this mosquito bites an other healthy person, the parasites migrate into his blood with the saliva, which the mosquito injects before sucking up blood to prevent its clotting.
(c)Ascariasis – Transmitted through water, vegetables, fruits etc. contaminated with the eggs of the parasites.
(d)Pneumonia – Spreads by cough & sneezes, by sharing drinking glass & eating utensils with an infected person.

4.What measures would you take to prevent water borne diseases?
Ans: Water borne diseases can be prevented by –
(i) Oral dehydration
(ii) Health education
(iii) Control of reservoirs
(iv) Immunization
(v) General hygiene, pure water

5. Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
Ans: A DNA vaccine consists of a suitable gene encoding an antigenic protein, inserted into a plasmid, and then incorporated into the cells in a target animal. The plasmid vaccine carrying the DNA (gene) enters the nucleus of target cells and produces RNA, and in turn the specific antigenic protein, because these proteins are recognized as foreign. When they are processed by the host cells and displayed on their surface, the immune system is alerted, which then triggers a range of immune responses.

6. Name the primary and secondary lymphoid organs.
Ans: Primary lymphoid organs – Bone marrow and thymils.
Secondary lymhoid organs – Spleen, lymph nodes, tonsils.

7. The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its fall form:
(a) MALT
(b) CMI

(c) AIDS
(d)NACO

(e) HIV
Ans: (a) MALT – Mucosal Associated Lymphoid Tissue
(b) CMI-Cell-Mediated Immunity
(c) AIDS – Acquired Immuno Deficiency syndrome
(d) NACO – National AIDS Control Organization
(e) HIV – Human Immuno Deficiency Virus

8. Differentiate the following and give examples of each
(a) Innate and acquired immunity
(b) Active and passive immunity
Ans: (a) Innate & acquired immunity
Innate immunity, also called inherent, natural, non specific immunity, comprises all those defence elements with which an individual is bom & which are always available to protect a living body. It acts on many organisms and does not show specificity, e.g. Lysozyme present in secretions such as tears, catalyzes the hydrolysis of molecules in the cell walls of bacteria & interferon induces antiviral state in non infected cells. They act as physiological barriers & check the growth of many pathogenic micro-organisms. Acquired immunity, also called adaptive or specific immunity, is the immunity obtained either from the development of antibodies in .response to exposure to an antigen, as from vaccination or an attack of an infectious diseases or from the transmission of antibodies as from mother to foetus through the placenta.

(b) Active & passive immunity
Active immunity is acquired by catching & surviving an infectious disease or by vaccination with a weakened form of the diseases which makes the body to form antibodies. Whereas passive immunity is conferred by transfer of immune products like antibodies etc. from other individual

9. Draw a well-labelled diagram of an antibody
Ans:
NCERT Solutions For Class 12 Biology Human Health and Disease Q9

10. What are the various routes by which trans-mission of human immunodeficiency virus takes place?
Ans: Various routes by which transmission of human immunodeficiency virus takes place are
(i) Illicit sexual contact.
(ii) Sexual contact with multiple partners.
(iii) Transfusion of the blood of infected person.
(iv) Intravenous drug users that shares needles are at high risk of contracting AIDS.

11. What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?
Ans: HIV critically injures the immune system by infecting and eventually killing T-cells. Once the virus has infected a T cell, HIV copies its RNA into double stranded DNA copy by mearis of viral enzyme reverse transcriptase. This process is called reverse transcriptase because it violates the usual way in which genetic information is transcribed. Because reverse transcriptase lacks thg proofreading function that most DNA synthesizing enzymes have, many mutations arises as the virus replicates, further hindering the ability of the immune system to combat the virus. These mutations allow the virus to evolve rapidly resulting in the lost of vital cells. As a result of progressive destruction of its T-cells, the body is easily ravaged by a number of common infectious agents. In many instances, these infections would have caused little injury if there functional T-cells clones available.
Death ultimately results from the relentless attack of opportunistic pathogens or from the body’s inability to fight off malignancies.
virus. These mutations allow the virus to evolve rapidly resulting in the lost of vital cells. As a result of progressive destruction of its T-cells, the body is easily ravaged by a number of common infectious agents. In many instances, these infections would have caused little injury if there functional T-cells clones available.
Death ultimately results from the relentless attack of opportunistic pathogens or from the body’s inability to fight off malignancies.

12. How is a cancerous cell different from a normal cell?
Ans: Cancer is a disease characterized by the excessive and abnormal growth of certain cells. In a healthy individual, the growth of cells is balanced by the rate of cell loss. Thus, when one attains adult age, the size and cellular contents of various body organs remain constant. The balance between the growth of the cells and the rate of cell class may be dislocated by certain chemicals, physical stresses and viral agents. As a result, the normal growth of the cells may be transformed into cancerous one. Cancerous cells acquire the ability to invade new sites, a phenomenon called metastasis. They exhibit a number of alterations on cell surface, in the cytoplasm, and in their genes. These features are used for the identification of cancers.

13. Explain what is meant by metastasis.
Ans: Metastasis is the phenomenon in which cancer cells due to unregulated proliferation spread to distant sites through body fluids to develop secondary tumors. Only malignant tumors show the property of metastasis.

14. List the harmful effects caused by alcohol/drug abuse.
Ans: Harmful effects caused by alcohol abuse are –
(i) Alcohol generates more energy mostly in the form of heat, but at the same time, it dilates the blood vessels. Consequently the ‘heat generated is rapidly lost. Due to constant dilation, the arterial walls soon become brittle & rigid. Such a change in the property of blood vessels & deposition of alcoholic fat affect the working of heart.
(ii) Alcoholism leads to gastric ulcers & gastritis.
(iii) In chronic alcoholism, the axon of the nerve inflame thus causing neuritis.
(iv) Permanent damage to liver cells occur due to deposition of fats. The liver dries up & harden (cirrhosis).
Harmful effects caused by drug abuse are –
(i) Excessive doses of drugs may lead to coma & death due to respiratory failure, heart failure & cerebral haemorrhage.
(ii) Lack of interest in personal hygiene, withdrawal, isolation, depression, fatigue aggressive & rebellious behaviour etc.
(iii) Acquire serious infections like AIDS & hepatitis B, who take drugs intravenously.
(iv) The adverse effects of drugs are manifested in the form of reckless behaviour, vandalism & violence.

15. Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence?
Ans: Yes, friends can influence one to take drugs. Following measures can be taken:
(i) Avoiding undue peer pressure.
(ii) Not taking undue pressure of failures beyond its threshold.
(iii) Getting counselling from some counsellor
(iv) Seeking help from parents and peers
(v) Seeking medical help

16. Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.
Ans: Psychological & physiological dependence of an individual to the intake of certain kinds of drugs and alcohol is called addiction. Once a person start taking alcohol & drugs, it is very difficult to get rid this habit because addiction drive people to take them even when these are not needed or even when their use becomes self destructive. With repeated use of drugs, the tolerance level of the receptors present in the body increases, consequently, the receptors responds only to higher doses of drugs or alcohgl leading to greater intake & addiction. Thus, the addiction potential of drugs & alcohol, pull the user into a vicious circle leading to their regular use (abuse) from which he/she may not able to get out.

18. In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?
Ans: Human have probably been using mind – affecting drugs since time immemorial. The root cause of addiction of man to drugs, smoking and drinking has been due to his inability to make mental adjustments with stresses and strains, drudgery and extreme misery in daily life. As a temporary measure, to combat these adverse situations and to have a certain degree of mental relaxation, humans have been making an extensive use of stimulants, depressants and hallucinogens. Stimulants generally speed up body process, and depressants slow them. Hallucinogens can alter a person’s thoughts, feelings, and perception.
In preventing drug abuse, the role of parents
could be:
(i) Communicate openly with the children, listen to their problems patiently and teach them how to handle the problems.
(ii) Take interest in children’s activities and their friends circle.
(iii) Set an example for children by not taking drugs or alcohol.
(iv) Keep track of prescribed drugs in home.
(v) Learn as much as possible about drugs.

NCERT Solutions For Class 12 Biology Evolution

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 7 Evolution:

Section NameTopic Name
7Evolution
7.1Origin of Life
7.2Evolution of Life Forms – A Theory
7.3What are the Evidences for Evolution?
7.4What is Adaptive Radiation?
7.5Biological Evolution
7.6Mechanism of Evolution
7.7Hardy – Weinberg Principle
7.8A Brief Account of Evolution
7.9Origin and Evolution of Man
7.10Summary

NCERT Solutions For Class 12 Biology Chapter 7 Questions From Textbook Solved

Evolution Chapter Class 12 NCERT  Q1. Explain antibiotic, resistance observed in bacteria in light of Darwinian selection theory.
Ans: According to Darwin, environment selects organisms with favourable variations and these organisms are allowed to survive. When a bacterial population encounters a particular antibiotic, those sensitive to it die. But some bacteria having mutations become resistant to the antibiotic. Such resistant bacteria survive and multiply quickly as the competing bacteria have died. Some the resistance providing genes become widespread and entire bacterial population becomes resistant.

Evolution Class 12 NCERT Solutions Q2. Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution
Ans: New fossil discoveries are as follows :

1. An international research team has recently discovered some amber fly specimens in El Sopalo cave (Cantabria, Spain). According to an article published in the scientific journal ‘Current Biology’, these specimens fed on nector and pollinated gymnosperm plants 105 million years ago.

2. Research conducted in Japan has revealed a very unusual new species of octocoral from a shallow coral reef in Okinawa, Japan. This new species can be considered as “living fossil,” and is related in many ways to the unusual blue coral.

3. The 48 million year old fossil, recovered from the Bridger Formation in Wyoming, is the first description of a new species, named Babibasiliscusalxiby the author, and
may represent the earliest clear member of the lizard group, Corytophanidae.

4. Neanderthals became extinct about 40,000 years ago but contributed on average one to three percent to the genomes of present day Eurasians. Researchers have now analysed DNA from a 37,000 to 42,000 year old human mandible in Romania and have found that six to nine percent of this person’s genome came from Neanderthals, more than any other human sequenced till date. Because large segments of this individual’s chromosomes are of Neanderthal origin, a Neanderthal was among his ancestors as recently as four to six generations back in his family tree. This shows that some of the first modern humans that came to Europe mixed with the local Neanderthals.

Chapter 7 Biology Class 12 NCERT Solutions Q3. Attempt giving a clear definition of the term species.
Ans: Species is population or group of individuals that have potential of interbreeding and are able to produce viable, fertile young ones but are reproductively isolated from members of other species.

Evolution NCERT Solutions  Q4. Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)
Ans:
NCERT Solutions For Class 12 Biology Evolution Q4
Dietary preference:
Dryopithecus and Ramapithecus — herbivores Australopithecus Africans, Homo Carnivores habilis
Homo erectus, Homo sapinens — Omnivores

Evolution NCERT Solutions Class 12  Q5. Find out through internet and popular science articles whether animals other than man has self-consciousness.
Ans: Recent studies on self consciousness says gibbons are the nearest to human in this respect. Apes and orangutans came next. Among domestic animals, dog and other members of canidae family show subtle self consciousness.

Evolution NCERT  Q6.List 10 modern-day animals and using the” internet resources link it to a corresponding ancient fossil. Name both.
Ans: (i) Cockroach, Limulus (king crab), Neopilina, Latimaria (Fish) are fossil that has remain unchanged over years.
(ii) ‘Trilobites- fossil arthropods
(iii) Lung fishes – connecting link between fishes and amphibians
(iv) Peripatus – connecting link between annelids and arthropods .
(v) Woody mammoth – ice fossils
(vi) Gastropods – mould and cast fossil
(vii) Giant elk – amber fossil of asphalt
(viii) Dinosaur footprint – imprints

NCERT Solutions of Evolution Class 12  Q7. Practise drawing various animals and plants.
Ans: (1) Elephant
NCERT Solutions For Class 12 Biology Evolution Q7
(2) Camel
NCERT Solutions For Class 12 Biology Evolution Q7.1
(3) Dog
NCERT Solutions For Class 12 Biology Evolution Q7.2
(4) Rose
NCERT Solutions For Class 12 Biology Evolution Q7.3
(5) Dahlia
NCERT Solutions For Class 12 Biology Evolution Q7.4
(6) hibiscus
NCERT Solutions For Class 12 Biology Evolution Q7.5

Class 12 Biology Chapter 7 NCERT Solutions  Q8.Describe one example of adaptive radiation.
Ans: Darwin’s finches of the Galapagos islands had common ancestors but now have different types of modified beaks according to their food habits.

Evolution Questions And Answers Class 12 Q9. Can we call human evolution as adaptive radiation?
Ans: Yes, human evolution is an example of adaptive radiation as different species of human evolved across different areas of world as they diverged to different areas in following fashion.
(i) Hominid introduction occured in Africa and Asia:
(ii) Homo habilis lived in Africa – 2 million years ago.
(iii) Homo erectus- migrated to Asia and Europe and diverged into 2 species – Java Man and Peking Man.
(iv) Similarly Homo erectus – was followed by Homo sapiens.
(v) Primitive neanderthal man in Europe gave way to African cromagnon.
NCERT Solutions For Class 12 Biology Evolution Q9

Evolution Class 12 NCERT Q10. Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse.
Ans: Evolutionary stages of horse:
Eohippus – Mesohippus – Merychippus – Pliohippus – Equus.
Evolutionary trend:
(i) Increase in body size.
(ii) Elongation of neck.
(iii) Lengthening of limbs.
(iv) Enlargement of third digit.
(v) Increase in structural complexity of teeth for feeding on grass.

NCERT Solutions For Class 12 Biology Molecular Basis of Inheritance

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance:

Section NameTopic Name
6Molecular Basis of Inheritance
6.1The DNA
6.2The Search for Genetic Material
6.3RNA World
6.4Replication
6.5Transcription
6.6Genetic Code
6.7Translation
6.8Regulation of Gene Expression
6.9Human Genome Project
6.10DNA Fingerprinting
6.11Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Ans: Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Ans: In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Write down the sequence of complementary strand in 5′ —> 3′ direction.
Ans: If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
The sequence of the complementary strand in 5′ —> 3′ direction will be:
5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

4. If the sequence of the coding strand in a transcription unit is written as follows: 5-ATGCATGCATGCATGCATGCA TGCATGC-3′
Write down the sequence of mRNA.
Ans: mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain
Ans: The antiparallel, double-stranded nature of the DNA molecule led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They suggested that the two strands of DNA molecule uncoil and separate, and each strand serves as a template for the synthesis of a new (complementary) strand alongside it. The template and its complement, then form a new DNA double strand, identical to the original DNA molecule. The sequence of bases which should be present in the new strands can be easily predicted because these would be complementary to the bases present in the old strands. A will pair with T, T with A, C with G, and G with C. Thus, two daughter DNA molecules identical to the parent molecule are formed and each daughter DNA molecule consists of one old (parent) strand and one new strand. Since only one parent strand is conserved in each daughter molecule, this mode of replication is said to be semiconservative. Meselson and Stahl and Joseph Taylor, later proved it by experiments.

6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Ans: (i) DNA dependent DNA polymerase – synthesis.
(ii) DNA dependent RNA polymerase – synthesis.
(iii) RNA dependent DNA polymerase – Retroviral nucleic acid.
(iv) RNA dependent RNA polymerase – cDNA synthesis.

7. How did Hershey and Chase differentiate between DNA and protein in their experiment white proving that DNA is the genetic material?
Ans: Alfred Hershey and Martha Chase (1952) worked with viruses that infect bacteria called bacteriophages. In 1952, they chose a bacteriophage known as T2 for their experimental material.
They grew some viruses on a medium that contained radioactive phosphorus (p32) and some others on medium that contained radioactive sulphur (s35). Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protem does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radio’active DNA because DNA does not contain sulphur.
Radioactive phages were allowed to attach to E. coli bacteria. Then, as the infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge. ,
Bacteria which was infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicates that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from virus to bacteria.

8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNAand tRNA
(c) Template strand and Coding strand
Ans: (a) The main differences between repetitive DNA and satellite DNA are as following:
(b) The main difference between mRNA and tRNA are as following:
(c) The main difference between template strand and coding strand are as follows :

9. List two essential roles of ribosome during translation.
Ans: Two essential roles of ribiosomes during translation are ;o
(i) they provide surface for binding of mRNA in the groove of smaller sub unit of ribosome.
(ii) As larger sub unit of ribosome has peptidy transferase on its ‘P’ site, therefore, it helps in joining amino acids by forming peptide bonds. .

10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?
Ans: Lac operon is switched on, on adding lactose in medium, as lactose acts as inducer and makes repressor inactive by binding with it. When the lac operon system is switched on, β-galactosidase is formed, which converts lactose into glucose and galactose. As soon as all the lactose is consumed, repressor again becomes active and causes the system to switch off (shut down).

11. Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA

(c) Exons
Ans: Promoter: It is one of the three components of a transcription unit that takes part in transcription. It is located at the start 5′ end and provides site for attachment of transcription factors (TATA Box) and RNA polymerase. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome for their taking part in protein formation.
Exons: In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are transcribed and translated both.

12. Why is the Human genome project called a mega project?
Ans: Human genome project is called a mega project because
(i) it required bioinformatics data basing and other high speed computational devices for analysis, storage and retrieval of information.
(ii) it generated lot of information in the form of sequence annotation.
(iii) it was carried out in number of labs and coordinated on extensive scale.

13. What is DNA fingerprinting? Mention its application.
Ans: DNA fingerprinting or DNA typing is a technique of determining nucleotide sequences of certain areas (VNTRs) of DNA which are unique to each individual. Each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organ of a person. It cannot be changed by any known treatment. Applications of DNA fingerprinting are as follows:

  • Paternity disputes can be solved by DNA fingerprinting.
  • DNA fingerprinting technique is being used to identify genes connected with hereditary diseases.
  • It is useful in detection of crime and legal pursuits.
  • It can identify racial groups, their origin, historical migrations and invasions.

14. Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics

Ans: Transcription : It is DNA directed synthesis of RNA in which the RNA is transcribed on 3*—>5’ template strand of DNA in 5’—>3’ direction. Polymorphism: Variation at genetic level arisen due,to mutation, is called polymorphism. Such variations are unique at particular site of DNA, forming satellite DNA. The polymorphism in DNA sequences is the basis of genetic mapping and DNA finger printing.
Translation : Protein synthesis from mRNA, tRNA, rRNA.
Bioinformatics : Computational method of handling and analyzing biological databases.